BLASTN 2.2.3 [Apr-24-2002]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= psbL.F
         (117 letters)

Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa 
           29,161 sequences; 44,058,232 total letters

Searching..................................................done


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AtCg00560  psbL#PSII L protein                                    232   5e-61
At5g61420.1  68418.m07706 myb family transcription factor (M...    34   0.22 
At3g23390.1  68416.m02949 60S ribosomal protein L36a/L44 (RP...    32   0.89 
At1g10770.1  68414.m01233 invertase/pectin methylesterase in...    32   0.89 
At5g05000.3  68418.m00531 translocate of chloroplast 34 (TOC...    30   3.5  
>AtCg00560 psbL#PSII L protein
          Length = 117

 Score =  232 bits (117), Expect = 5e-61
 Identities = 117/117 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacacaatcaaatccgaacgaacaaagtgttgaattaaatcgtaccagtctctattgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atgacacaatcaaatccgaacgaacaaagtgttgaattaaatcgtaccagtctctattgg 60

                                                                    
Query: 61  gggttattactcatttttgtacttgctgttttattttcgaattatttcttcaattaa 117
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gggttattactcatttttgtacttgctgttttattttcgaattatttcttcaattaa 117
>At5g61420.1 68418.m07706 myb family transcription factor (MYB28) contains Pfam
           profile: PF00249 myb-like DNA-binding domain
          Length = 1805

 Score = 34.2 bits (17), Expect = 0.22
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 69  actcatttttgtacttg 85
           |||||||||||||||||
Sbjct: 456 actcatttttgtacttg 472
>At3g23390.1 68416.m02949 60S ribosomal protein L36a/L44 (RPL36aA) similar to
           ribosomal protein L41 GB:AAA34366 from [Candida maltosa]
          Length = 536

 Score = 32.2 bits (16), Expect = 0.89
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 73  atttttgtacttgctg 88
           ||||||||||||||||
Sbjct: 395 atttttgtacttgctg 410
>At1g10770.1 68414.m01233 invertase/pectin methylesterase inhibitor family
           protein contains Pfam profile PF04043: Plant
           invertase/pectin methylesterase inhibitor
          Length = 779

 Score = 32.2 bits (16), Expect = 0.89
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 102 ttatttcttcaattaa 117
           ||||||||||||||||
Sbjct: 617 ttatttcttcaattaa 602
>At5g05000.3 68418.m00531 translocate of chloroplast 34 (TOC34) / GTP-binding
           protein (OEP34) contains Pfam PF04548: AIG1
           family;contains TIGRFAM TIGR00991: GTP-binding protein
           and TIGR00231: small GTP-binding protein domain; 99.7%
           identical to atToc34 protein (GI:11557975) [Arabidopsis
           thaliana]; similar to Chain A, Pea Toc34 - A Novel
           Gtpase Of The Chloroplast Protein Translocon
           (GI:1865556) [Pisum sativum]; almost identical to
           SP:Q38906 Translocase of chloroplast 34; identical to
           cDNA GTP-binding protein (OEP34) GI:1151243
          Length = 1354

 Score = 30.2 bits (15), Expect = 3.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                          
Query: 66  attactcatttttgt 80
           |||||||||||||||
Sbjct: 152 attactcatttttgt 166
  Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
    Posted date:  Jun 25, 2004 12:58 PM
  Number of letters in database: 44,058,232
  Number of sequences in database:  29,161
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3252
Number of Sequences: 29161
Number of extensions: 3252
Number of successful extensions: 787
Number of sequences better than 10.0: 17
length of query: 117
length of database: 44,058,232
effective HSP length: 16
effective length of query: 101
effective length of database: 43,591,656
effective search space: 4402757256
effective search space used: 4402757256
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)