BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= psbL.F
(117 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AtCg00560 psbL#PSII L protein 232 5e-61
At5g61420.1 68418.m07706 myb family transcription factor (M... 34 0.22
At3g23390.1 68416.m02949 60S ribosomal protein L36a/L44 (RP... 32 0.89
At1g10770.1 68414.m01233 invertase/pectin methylesterase in... 32 0.89
At5g05000.3 68418.m00531 translocate of chloroplast 34 (TOC... 30 3.5
>AtCg00560 psbL#PSII L protein
Length = 117
Score = 232 bits (117), Expect = 5e-61
Identities = 117/117 (100%)
Strand = Plus / Plus
Query: 1 atgacacaatcaaatccgaacgaacaaagtgttgaattaaatcgtaccagtctctattgg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgacacaatcaaatccgaacgaacaaagtgttgaattaaatcgtaccagtctctattgg 60
Query: 61 gggttattactcatttttgtacttgctgttttattttcgaattatttcttcaattaa 117
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 gggttattactcatttttgtacttgctgttttattttcgaattatttcttcaattaa 117
>At5g61420.1 68418.m07706 myb family transcription factor (MYB28) contains Pfam
profile: PF00249 myb-like DNA-binding domain
Length = 1805
Score = 34.2 bits (17), Expect = 0.22
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 69 actcatttttgtacttg 85
|||||||||||||||||
Sbjct: 456 actcatttttgtacttg 472
>At3g23390.1 68416.m02949 60S ribosomal protein L36a/L44 (RPL36aA) similar to
ribosomal protein L41 GB:AAA34366 from [Candida maltosa]
Length = 536
Score = 32.2 bits (16), Expect = 0.89
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 73 atttttgtacttgctg 88
||||||||||||||||
Sbjct: 395 atttttgtacttgctg 410
>At1g10770.1 68414.m01233 invertase/pectin methylesterase inhibitor family
protein contains Pfam profile PF04043: Plant
invertase/pectin methylesterase inhibitor
Length = 779
Score = 32.2 bits (16), Expect = 0.89
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 102 ttatttcttcaattaa 117
||||||||||||||||
Sbjct: 617 ttatttcttcaattaa 602
>At5g05000.3 68418.m00531 translocate of chloroplast 34 (TOC34) / GTP-binding
protein (OEP34) contains Pfam PF04548: AIG1
family;contains TIGRFAM TIGR00991: GTP-binding protein
and TIGR00231: small GTP-binding protein domain; 99.7%
identical to atToc34 protein (GI:11557975) [Arabidopsis
thaliana]; similar to Chain A, Pea Toc34 - A Novel
Gtpase Of The Chloroplast Protein Translocon
(GI:1865556) [Pisum sativum]; almost identical to
SP:Q38906 Translocase of chloroplast 34; identical to
cDNA GTP-binding protein (OEP34) GI:1151243
Length = 1354
Score = 30.2 bits (15), Expect = 3.5
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 66 attactcatttttgt 80
|||||||||||||||
Sbjct: 152 attactcatttttgt 166
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3252
Number of Sequences: 29161
Number of extensions: 3252
Number of successful extensions: 787
Number of sequences better than 10.0: 17
length of query: 117
length of database: 44,058,232
effective HSP length: 16
effective length of query: 101
effective length of database: 43,591,656
effective search space: 4402757256
effective search space used: 4402757256
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)