BLASTN 2.2.3 [Apr-24-2002]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= psaI.F
         (114 letters)

Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa 
           29,161 sequences; 44,058,232 total letters

Searching..................................................done


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AtCg00510  psaI#PSI I protein                                     226   3e-59
At1g19660.1  68414.m02450 wound-responsive family protein si...    34   0.22 
At1g11430.1  68414.m01313 plastid developmental protein DAG,...    34   0.22 
At5g55780.1  68418.m06952 DC1 domain-containing protein cont...    32   0.86 
At5g46200.1  68418.m05684 expressed protein contains similar...    32   0.86 
>AtCg00510 psaI#PSI I protein
          Length = 114

 Score =  226 bits (114), Expect = 3e-59
 Identities = 114/114 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacaactttcaataacttaccctctatttttgtgcctttagtaggcctagtctttccg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atgacaactttcaataacttaccctctatttttgtgcctttagtaggcctagtctttccg 60

                                                                 
Query: 61  gcaattgcaatggcttctttatttcttcatattcaaaaaaataagattttttag 114
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gcaattgcaatggcttctttatttcttcatattcaaaaaaataagattttttag 114
>At1g19660.1 68414.m02450 wound-responsive family protein similar to wound
            inducive gene (GI:8096273)[Nicotiana tabacum]
          Length = 1379

 Score = 34.2 bits (17), Expect = 0.22
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 67   gcaatggcttctttatt 83
            |||||||||||||||||
Sbjct: 1150 gcaatggcttctttatt 1134
>At1g11430.1 68414.m01313 plastid developmental protein DAG, putative similar
          to DAG protein, chloroplast precursor [Garden
          snapdragon] SWISS-PROT:Q38732
          Length = 946

 Score = 34.2 bits (17), Expect = 0.22
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                           
Query: 61 gcaattgcaatggcttc 77
          |||||||||||||||||
Sbjct: 15 gcaattgcaatggcttc 31
>At5g55780.1 68418.m06952 DC1 domain-containing protein contains Pfam profile
            PF03107: DC1 domain
          Length = 2058

 Score = 32.2 bits (16), Expect = 0.86
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                            
Query: 64   attgcaatggcttctt 79
            ||||||||||||||||
Sbjct: 1358 attgcaatggcttctt 1373
>At5g46200.1 68418.m05684 expressed protein contains similarity to
           carboxyl-terminal proteinase contains Pfam profile
           PF03080: Arabidopsis proteins of unknown function;
           expression supported by MPSS
          Length = 1227

 Score = 32.2 bits (16), Expect = 0.86
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 93  tcaaaaaaataagatt 108
           ||||||||||||||||
Sbjct: 429 tcaaaaaaataagatt 444
  Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
    Posted date:  Jun 25, 2004 12:58 PM
  Number of letters in database: 44,058,232
  Number of sequences in database:  29,161
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3838
Number of Sequences: 29161
Number of extensions: 3838
Number of successful extensions: 1176
Number of sequences better than 10.0: 31
length of query: 114
length of database: 44,058,232
effective HSP length: 16
effective length of query: 98
effective length of database: 43,591,656
effective search space: 4271982288
effective search space used: 4271982288
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)