BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= psaI.F
(114 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AtCg00510 psaI#PSI I protein 226 3e-59
At1g19660.1 68414.m02450 wound-responsive family protein si... 34 0.22
At1g11430.1 68414.m01313 plastid developmental protein DAG,... 34 0.22
At5g55780.1 68418.m06952 DC1 domain-containing protein cont... 32 0.86
At5g46200.1 68418.m05684 expressed protein contains similar... 32 0.86
>AtCg00510 psaI#PSI I protein
Length = 114
Score = 226 bits (114), Expect = 3e-59
Identities = 114/114 (100%)
Strand = Plus / Plus
Query: 1 atgacaactttcaataacttaccctctatttttgtgcctttagtaggcctagtctttccg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgacaactttcaataacttaccctctatttttgtgcctttagtaggcctagtctttccg 60
Query: 61 gcaattgcaatggcttctttatttcttcatattcaaaaaaataagattttttag 114
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 gcaattgcaatggcttctttatttcttcatattcaaaaaaataagattttttag 114
>At1g19660.1 68414.m02450 wound-responsive family protein similar to wound
inducive gene (GI:8096273)[Nicotiana tabacum]
Length = 1379
Score = 34.2 bits (17), Expect = 0.22
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 67 gcaatggcttctttatt 83
|||||||||||||||||
Sbjct: 1150 gcaatggcttctttatt 1134
>At1g11430.1 68414.m01313 plastid developmental protein DAG, putative similar
to DAG protein, chloroplast precursor [Garden
snapdragon] SWISS-PROT:Q38732
Length = 946
Score = 34.2 bits (17), Expect = 0.22
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 61 gcaattgcaatggcttc 77
|||||||||||||||||
Sbjct: 15 gcaattgcaatggcttc 31
>At5g55780.1 68418.m06952 DC1 domain-containing protein contains Pfam profile
PF03107: DC1 domain
Length = 2058
Score = 32.2 bits (16), Expect = 0.86
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 64 attgcaatggcttctt 79
||||||||||||||||
Sbjct: 1358 attgcaatggcttctt 1373
>At5g46200.1 68418.m05684 expressed protein contains similarity to
carboxyl-terminal proteinase contains Pfam profile
PF03080: Arabidopsis proteins of unknown function;
expression supported by MPSS
Length = 1227
Score = 32.2 bits (16), Expect = 0.86
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 93 tcaaaaaaataagatt 108
||||||||||||||||
Sbjct: 429 tcaaaaaaataagatt 444
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3838
Number of Sequences: 29161
Number of extensions: 3838
Number of successful extensions: 1176
Number of sequences better than 10.0: 31
length of query: 114
length of database: 44,058,232
effective HSP length: 16
effective length of query: 98
effective length of database: 43,591,656
effective search space: 4271982288
effective search space used: 4271982288
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)